Cookie-Einstellungen
Diese Website benutzt Cookies, die für den technischen Betrieb der Website erforderlich sind und stets gesetzt werden. Andere Cookies, die den Komfort bei Benutzung dieser Website erhöhen, der Direktwerbung dienen oder die Interaktion mit anderen Websites und sozialen Netzwerken vereinfachen sollen, werden nur mit Ihrer Zustimmung gesetzt.
Konfiguration
Technisch erforderlich
Diese Cookies sind für die Grundfunktionen des Shops notwendig.
"Alle Cookies ablehnen" Cookie
"Alle Cookies annehmen" Cookie
Ausgewählter Shop
CSRF-Token
Cookie-Einstellungen
FACT-Finder Tracking
Individuelle Preise
Kundenspezifisches Caching
Session
Währungswechsel
Komfortfunktionen
Diese Cookies werden genutzt um das Einkaufserlebnis noch ansprechender zu gestalten, beispielsweise für die Wiedererkennung des Besuchers.
Facebook-Seite in der rechten Blog - Sidebar anzeigen
Merkzettel
Statistik & Tracking
Endgeräteerkennung
Kauf- und Surfverhalten mit Google Tag Manager
Partnerprogramm
Artikelnummer | Größe | Datenblatt | Manual | SDB | Lieferzeit | Menge | Preis |
---|---|---|---|---|---|---|---|
BPS-78893 | 1 ml (500 µl x 2) | - | - |
3 - 15 Werktage* |
1.223,00 €
|
Bei Fragen nutzen Sie gerne unser Kontaktformular.
Bestellen Sie auch per E-Mail: info@biomol.com
Größere Menge gewünscht? Bulk-Anfrage
Bestellen Sie auch per E-Mail: info@biomol.com
Größere Menge gewünscht? Bulk-Anfrage
The BCMA CRISPR/Ca9 Lentiviruses are replication incompetent, HIV-based, VSV-G pseudo-typed... mehr
Produktinformationen "BCMA CRISPR/Cas9 Lentivirus (Integrating)"
The BCMA CRISPR/Ca9 Lentiviruses are replication incompetent, HIV-based, VSV-G pseudo-typed lentiviral particles that are ready to transduce most mammalian cells, including primary and non-dividing cells. These viruses contain a CRISPR/Cas9 gene, driven by an EF1A promoter, and 5 sgRNA (single guide RNA) targeting human BCMA (B-cell maturation antigen) driven by a U6 promoter (see Table 1 for sgRNA sequences). The integrating lentivirus integrates randomly into the cell's genome to express both the Cas9 and sgRNAs. Simultaneous expression of Cas9 and BCMA sgRNA allows the generation of BCMA-knockout cells with one single transduction step. The lentiviruses also contain a puromycin selection marker. List of sgRNA sequences in the BCMA CRISPR/Cas9 Lentivirus. Gene Target: Primer ID: sgRNA Sequence: TNFRSF17 (BCMA) TNFRSF17-1 CCTCTAACATGTCAGCGTTA TNFRSF17 (BCMA) TNFRSF17-2 TGTCAACTTCGATGTTCTTC TNFRSF17 (BCMA) TNFRSF17-3 CGAGTACACGGTGGAAGAAT TNFRSF17 (BCMA) TNFRSF17-4 TTCACTGAATTGGTCACACC TNFRSF17 (BCMA) TNFRSF17-5 GTGTTTTTAAACTCGTCCTT Note: BPS Bioscience also offers a non-integrating version of this product (BPS Bioscience #78894).
Schlagworte: | knockout, knock-out, KO, |
Hersteller: | BPS Bioscience |
Hersteller-Nr: | 78893 |
Eigenschaften
Anwendung: | BCMA knock-out/BMCA knock-out cell pool generation, stable BCMA knock-out cell line generation |
Spezies-Reaktivität: | human |
Datenbank Information
KEGG ID : | K05153 | Passende Produkte |
UniProt ID : | Q02223 | Passende Produkte |
Gene ID : | GeneID 608 | Passende Produkte |
Handhabung & Sicherheit
Lagerung: | -80°C (avoid repeat freezing and thawing cycles) |
Versand: | -80°C (International: °C) |
Achtung
Nur für Forschungszwecke und Laboruntersuchungen: Nicht für die Anwendung im oder am Menschen!
Nur für Forschungszwecke und Laboruntersuchungen: Nicht für die Anwendung im oder am Menschen!
Hier kriegen Sie ein Zertifikat
Loggen Sie sich ein oder registrieren Sie sich, um Analysenzertifikate anzufordern.
Bewertungen lesen, schreiben und diskutieren... mehr
Kundenbewertungen für "BCMA CRISPR/Cas9 Lentivirus (Integrating)"
Bewertung schreiben
Loggen Sie sich ein oder registrieren Sie sich, um eine Produktbewertung abzugeben.
Zuletzt angesehen